Advances in diagnosis and treatment of myocardial damage in childern DMD/BMD / 国际儿科学杂志

Duchenne/Becker muscular dystrophy(DMD/BMD)is a progressive, destructive neuromuscular disease.It is caused by mutations in the gene encoding dystrophy.The mutations come in various forms and the severity of the disease varies.The onset of the disease is insidious, and the initial manifestation is only abnormal serum enzymes.With the progression of the disease, the skeletal muscle and myocardial striated muscle cells are further destroyed, gait abnormalities and myocardial damage gradually appear, and eventually most children die of heart failure.At present, there is no effective radical cure.The existing treatment methods, including oral glucocorticoids and restoring functional dystrophin, are mostly limited to alleviate skeletal muscle symptoms, and are very limited to improve cardiac symptoms.This article reviews the progress in the diagnosis and treatment of myocardial damage in DMD/BMD, in order to provide reference for clinical research and gene therapy.

Comparative study of conventional MRI between Duchenne muscular dystrophy and Becker muscular dystrophy / 中国医学影像技术

Objective: To investigate the value of conventional MRI in differential diagnosis of Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD). Methods: The imaging data of the hip and thigh muscles of 697 patients with dystrophinopathy were retrospectively analyzed, and the similarities and differences of signs between DMD and BMD were compared. Results: The distribution of muscle fat infiltration in DMD and BMD patients was consistent, the total fat infiltration degree of DMD patients was higher than BMD patients (P=0.034), with the most obvious gluteus maximus, rectus femoris and sartorius; there was no significant difference in the degree of total muscle edema (P=0.065), however, the edema of the posterior thigh and sartorius of DMD was significantly higher than that of BMD. The selective involvement of muscle atrophy and hypertrophy was consistent between DMD and BMD patients, the frequency of atrophy of BMD lateral femoris, middle femoris, medial femoris, Semimembranosus and long head of biceps was significantly higher than that of DMD (P0.05). Conclusion: Conventional MRI can differentiate DMD from BMD.

Dystrophinopathy / 中华神经科杂志

Dystrophinopathy is a group of inherited diseases caused by the defect of dystrophin protein with X-linked recessive inheritance.The disease is clinically characterized by progressive severe muscles weakness and atrophy of proximal limb muscles and belt muscle,gastrocnemius pseudohypertrophy.The patient lose the ability of daily exercise,and ultimately succumb to restrictive lung disease or cardiac death.According to the clinical manifestations and the defect degree of dystrophin protein,dystrophinopathy is divided into:Duchenne muscular dystrophy (DMD),Becker muscular dystrophy,X-linked dilated cardiomyopathy,and female carrier of DMD.Patients can present with multi-system involvement at different stages of the disease,which require multidisciplinary management to alleviate symptoms,prolong life and improve quality of life.Glucocorticoids can significantly extend the independent activity of children by 2-5 years.Due to the high incidence,poor quality of life in the early stage and high disability and lethality in the late stage,it is important to strengthen the understanding of neurologists about this disease and conduct early diagnosis,full management and genetic counseling.

Tratamiento farmacológico y génico en las distrofias musculares de Duchenne y Becker / Pharmacologic and genetic treatment in the Duchenne and Becker muscular dystrophies

Introducción: Las distrofias musculares son las enfermedades degenerativas más comunes dentro de las enfermedades neuromusculares, cursan con debilidad muscular que progresa hasta la pérdida de la deambulación y en la segunda década de vida surgen complicaciones cardíacas, respiratorias y ortopédicas. Objetivo: Analizar el estado actual de los tratamientos génico y farmacológico en las distrofias musculares de Duchenne y Becker Métodos: Se realizó una búsqueda en los meses de enero, febrero y marzo de 2018 en las bases de datos Medline, Cinhal, Web Of Science y Scopus. Se obtuvieron 232 resultados y después de aplicar los criterios de inclusión y exclusión, se consiguieron para analizar 15 artículos válidos para la revisión. Resultados: Los artículos analizados investigan mayoritariamente el efecto de las terapias mencionadas a nivel de funcionalidad y de síntesis de la proteína distrofina durante períodos largos, en los que participan muestras de tamaño y edades variadas tanto como distrofia muscular de Duchenne y como distrofia muscular de Becker. Conclusiones: Existen más artículos enfocados en la distrofia muscular de Duchenne que en la distrofia muscular de Becker. Esto puede ser debido a que la primera es la más grave y de peor pronóstico. Sigue siendo necesario realizar más estudios para avanzar sobre el estado actual de estos tratamientos(AU)

Introduction: Muscular dystrophies are one of the most common degenerative pathologies within neuromuscular diseases. They present muscular weakness that develops until loss of wandering and in the second decade of life can appear cardiac, respiratory and orthopaedic complications. Objective: To know the current state of genetic and pharmacology treatments in the Duchenne and Becker muscular dystrophies. Methods: A search was made from January to March 2018 at Medline, Cinhal, Web Of Science and Scopus databases. 232 results were obtained, and applying the inclusion and exclusion criteria, 15 acceptable articles for reviewing were found. Results: Analyzed articles mostly investigate the effect of the mentioned therapies in the levels of functionality and dystrophin protein synthesis during long periods, in which samples of different sizes and ages are used. Conclusions: There are more articles focused on Duchenne Muscular Dystrophy than Becker Muscular Dystrophy. That can be due to the fact that the first is the most severe and with the worst prognosis. It is still necessary to carry out more scientific studies to move forward from the current stage of these treatments(AU)

Molecular Analysis-Based Genetic Characterization of a Cohort of Patients with Duchenne and Becker Muscular Dystrophy in Eastern China / 中华医学杂志(英文版)

<p><b>Background</b>Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are common X-linked recessive neuromuscular disorders caused by mutations in dystrophin gene. Multiplex polymerase chain reaction (multiplex PCR) and multiplex ligation-dependent probe amplification (MLPA) are the most common methods for detecting dystrophin gene mutations. This study aimed to contrast the two methods and discern the genetic characterization of patients with DMD/BMD in Eastern China.</p><p><b>Methods</b>We collected 121 probands, 64 mothers of probands, and 15 fetuses in our study. The dystrophin gene was detected by multiplex PCR primarily in 28 probands, and MLPA was used in multiplex PCR-negative cases subsequently. The dystrophin gene of the remaining 93 probands and 62 female potential carriers was tested by MLPA directly. In fetuses, multiplex PCR and MLPA were performed on 4 fetuses and 10 fetuses, respectively. In addition, sequencing was also performed in 4 probands with negative MLPA.</p><p><b>Results</b>We found that 61.98% of the subjects had genetic mutations including deletions (50.41%) and duplications (11.57%). There were 43.75% of mothers as carriers of the mutation. In 15 fetuses, 2 out of 7 male fetuses were found to be unhealthy and 2 out of 8 female fetuses were found to be carriers. Exons 3-26 and 45-52 have the maximum frequency in mutation regions. In the frequency of exons individually, exon 47 and exon 50 were the most common in deleted regions and exons 5, 6, and 7 were found most frequently in duplicated regions.</p><p><b>Conclusions</b>MLPA has better productivity and sensitivity than multiplex PCR. Prenatal diagnosis should be applied in DMD high-risk fetuses to reduce the disease incidence. Furthermore, it is the responsibility of physicians to inform female carriers the importance of prenatal diagnosis.</p>

Analysis of two Chinese Han families with Duchenne/Becker muscular dystrophy / 上海交通大学学报（医学版）

Objective: To deepen the understanding of Duchenne/Becker muscular dystrophy by investigating dystrophin (DMD) gene variants in 2 Chinese Han families with this disease. Methods: Retrospective analysis of the clinical characteristics of the probands in two families with Duchnne/ Becker muscular dystrophy and the results of multiplex ligation-dependent probe amplification (MLPA) for the probands and their relatives was performed. Results: Three probands were identified by significantly-elevated creatine kinase levels. Two probands in family one are fraternal twin brothers with the same deletions of exons 8-9, while their mother has no abnormality at this site. The proband in family two is the little brother in a pair of fraternal twins with duplication of exons 48-51, and his mother has heterozygous duplication of exons 48-51. Conclusion: ① The presence of the same DMD gene mutation in the fraternal twins suggests that the mother may be a gonad chimera with this mutation if her gene detection of peripheral blood is normal. The mother must undergo prenatal gene diagnosis to reduce the risk of Duchenne/Becker muscular dystrophy in her offsprings. ② The exons 48-51 duplication of DMD gene is pathogenic mutation.

Clinical analysis of Duchenne/ Becker muscular dystrophy with transaminase elevation as the initial presenta-tion / 中华实用儿科临床杂志

Objective To analyze the clinical characteristics of Duchenne/ Becker muscular dystrophy (DMD/BMD)with the initial presentation of transaminase elevation,in order to improve the clinician's understanding of this disease,and reduce misdiagnosis and missed diagnosis. To investigate the relationship between the elevation of transami-nase and the early stage of DMD/ BMD,and to provide the strategy for early diagnosis. Methods Twenty - four pa-tients admitted to the hospital with elevated serum transaminase as the initial presentation from January 2012 to Decem-ber 2014,who were diagnosed as DMD/ BMD by genetic testing or muscle biopsy,were enrolled. Their clinical data and laboratory examinations were retrospectively analyzed,including clinical features,diagnostic steps,serum muscle en-zymes,genetic analysis,electromyography and muscle pathological changes. Results The 24 patients were all male without family history of DMD/ BMD prior to birth. The average visiting age was (3. 4 ± 1. 2)years (ranging from 0. 8 to 6. 1 years),and 87. 5％ (21 / 24 cases)of cases were preschool children aged 2 - 6 years. Hypertransaminasemia was found in 21 cases (87. 5％)during the kindergarten physical examination,1 case during pre - operative investigation and 2 cases during respiratory infection. Due to its insidious onset,the time interval between incidental finding of elevated transaminase and definitive diagnosis was between 0. 6 and 20. 4 months. Among them,16 cases (66. 7％)had obvious pseudohypertrophy of calf muscles,and 18 cases (81. 8％)showed different degrees of movement disorder,such as unable to jump,easy to fall,and difficulty in climbing stairs. In addition,18. 2％ cases (4 / 22 cases)had a delay in language development. The serum alanine aminotransferase and aspartate aminotransferase levels were 120. 3 - 761. 7 U/ L and 83. 3 - 675. 5 U/ L,respectively. Serum creatine kinase (CK)was found to be markedly elevated (ranging from 3940 to 27510 U/ L)in all patients. Electromyography showed myogenic damage in 13 / 23 cases (56. 5％). DMD gene deletions were found in 18 cases (75. 0％),and duplications in 4 cases (16. 7％). The muscle biopsy performed in 2 cases (8. 3％)multiplex ligation - dependent probe amplification (MLPA)- negative cases showed evidence of dystrophic features on routine histology. Immunohistochemistry showed absent dystrophin staining in all 2 MLPA - nega-tive cases. Conclusion The clinical manifestation of DMD/ BMD is not typical in the early stage,so it is easy to be neglected or misdiagnosed. Elevated ALT and AST are important clues in the early diagnosis of DMD/ BMD. Children with elevated transaminase,in the absence of other signs and symptoms of hepatic injury,may have occult muscular di-sease,most frequently DMD/ BMD. A thorough physical examination and history taking as well as the measurement of serum CK are helpful in the differential diagnosis. Genetic testing or muscle biopsy should be done early for correct diagnosis of DMD/ BMD.

Identification of two novel Duchenne muscular dystrophies mutations in patients with Becker muscular dystrophy

Duchenne and Becker muscular dystrophies (DMD and BMD, respectively) are X-linked neuromuscular disorders characterized by progressive muscle weakness and severe skeletal muscle degeneration. BMD is a milder form with a later onset. Patients with BMD tend to survive much longer than those with DMD. The differentiation between DMD and BMD is important in the genetic counseling of affected patients and their families. Since muscle biopsies are invasive procedures, the differential diagnosis of BMD and DMD is often dependent on the mutation identified in the DMD gene in affected patients. However, when a novel DMD mutation is identified, the differential diagnosis should be based on muscle biopsy findings with other clinical findings. Here we describe two Korean patients with BMD confirmed by muscle biopsy and genetic testing. Two novel exonic deletions in the DMD gene were identified.

Multiplex Ligation-Dependent Probe Amplification in X-linked Recessive Muscular Dystrophy in Korean Subjects

PURPOSE: Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are similar genetic disorders whose patterns of mutation and disease phenotypes might be expected to show differences among different countries. We analyzed multiplex ligation-dependent probe amplification (MLPA) data in a large number of Korean patients with DMD/BMD. MATERIALS AND METHODS: We obtained 130 positive MLPA results (86 DMD, 27 BMD, and 17 female carriers) from 272 candidates (237 clinically suspected patients and 35 possible female carriers) who took part in this study. We analyzed the mutation patterns among 113 patients diagnosed by MLPA and calculated deletion/duplication percentages from a total of 128 patients, including 15 patients who were diagnosed using methods other than MLPA. We also analyzed hot spot locations among the 130 MLPA-positive results. RESULTS: Most mutations were detected in a central hot spot region between exons 44 and 55 (80 samples, 60.6%). Unlike previous reports, a second frequently observed hot spot near the 5'-end was not distinctive. MLPA detected deletions in specific exons in 92 patients with DMD/BMD (71.8%) and duplications in 21 patients (16.4%). CONCLUSION: Our MLPA study of a large number of Korean patients with DMD/BMD identified the most frequent mutation hot spot, as well as a unique hot spot pattern. DMD gene mutation patterns do not appear to show significant ethnic differences.

Duchenne Muscular Dystrophy and Becker Muscular Dystrophy Confirmed by Multiplex Ligation-Dependent Probe Amplification: Genotype-Phenotype Correlation in a Large Cohort

BACKGROUND AND PURPOSE: Studies of cases of Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) confirmed by multiplex ligation-dependent probe amplification (MLPA) have determined the clinical characteristics, genotype, and relations between the reading frame and phenotype for different countries. This is the first such study from India. METHODS: A retrospective genotype-phenotype analysis of 317 MLPA-confirmed patients with DMD or BMD who visited the neuromuscular clinic of a quaternary referral center in southern India. RESULTS: The 317 patients comprised 279 cases of DMD (88%), 32 of BMD (10.1%), and 6 of intermediate phenotype (1.9%). Deletions accounted for 91.8% of cases, with duplications causing the remaining 8.2%. There were 254 cases of DMD (91%) with deletions and 25 (9%) due to duplications, and 31 cases (96.8%) of BMD with deletions and 1 (3.2%) due to duplication. All six cases of intermediate type were due to deletions. The most-common mutation was a single-exon deletion. Deletions of six or fewer exons constituted 68.8% of cases. The deletion of exon 50 was the most common. The reading-frame rule held in 90% of DMD and 94% of BMD cases. A tendency toward a lower IQ and earlier wheelchair dependence was observed with distal exon deletions, though a significant correlation was not found. CONCLUSIONS: The reading-frame rule held in 90% to 94% of children, which is consistent with reports from other parts of the world. However, testing by MLPA is a limitation, and advanced sequencing methods including analysis of the structure of mutant dystrophin is needed for more-accurate assessments of the genotype-phenotype correlation.

A case of Becker muscular dystrophy with early manifestation of cardiomyopathy / 소아과

An 18-year-old boy was admitted with chest discomfort, nausea, and dyspnea at rest. At the age of 3 years, he underwent muscle biopsy and dystrophin gene analysis owing to an enlarged calf muscle and elevated serum kinase level (6,378 U/L) without overt weakness; based on the results, Becker muscular dystrophy (BMD) was diagnosed. The dystrophin gene showed deletion of exons 45 to 49. He remained ambulant and could step upstairs without significant difficulties. A chest roentgenogram showed cardiomegaly (cardiothoracic ratio, 54%), and his electrocardiogram (ECG) showed abnormal ST-T wave, biatrial enlargement, and left ventricular hypertrophy. The 2-dimensional and M-mode ECGs showed a severely dilated left ventricular cavity with diffuse hypokinesis. The systolic indices were reduced, including fractional shortening (9%) and ejection fraction (19%). Despite receiving intensive medical treatment, he died from congestive heart failure 5 months after the initial cardiac symptoms. We report a case of BMD with early-onset dilated cardiomyopathy associated with deletion of exons 45 to 49. Early cardiomyopathy can occur in BMD patients with certain genotypes; therefore, careful follow-up is required even in patients with mild phenotypes of BMD.

Genetic Analysis of Dystrophin Gene for Affected Male and Female Carriers with Duchenne/Becker Muscular Dystrophy in Korea

Duchenne and Becker muscular dystrophy (DMD/BMD) are X-linked recessive disorders caused by mutation in dystrophin gene. We analyzed the results of a genetic test in 29 DMD/BMD patients, their six female relatives, and two myopathic female patients in Korea. As the methods developed, we applied different procedures for dystrophin gene analysis; initially, multiplex polymerase chain reaction was used, followed by multiplex ligation-dependent probe amplification (MLPA). Additionally, we used direct DNA sequencing for some patients who had negative results using the above methods. The overall mutation detection rate was 72.4% (21/29) in DMD/BMD patients, identifying deletions in 58.6% (17/29). Most of the deletions were confined to the central hot spot region between exons 44 and 55 (52.9%, 7/19). The percentage of deletions and duplications revealed by MLPA was 45.5% (5/11) and 27.2% (3/11), respectively. Using the MLPA method, we detected mutations confirming their carrier status in all female relatives and symptomatic female patients. In one patient in whom MLPA revealed a single exon deletion of the dystrophin gene, subsequent DNA sequencing analysis identified a novel nonsense mutation (c.4558G > T; Gln1520X). The MLPA assay is a useful quantitative method for detecting mutation in asymptomatic or symptomatic carriers as well as DMD/BMD patients.

Detection of duplication mutation and carriers of Duchenne/Becker muscular dystrophy by multiplex ligation-dependent probe amplification quantitative / 中华神经科杂志

Objective To analyze the dystrophin gene in patients with Duchenne/Becker muscular dystrophy (DMD/BMD) and their family members by multiplex ligation-dependent probe amplification (MLPA) method and to evaluate the application of this method in the mutations detection. Methods The whole dystrophin gene (79 exons) was analyzed by MLPA in 355 patients with DMD/BMD, the mothers of 46 patients with deletion mutation and the mothers of 8 patients with duplication mutation. The results were verified by PCR and sequencing when single exon deletion was found. Results One hundred and ninety cases were found to have deletion of one or more dystrophin exons, and 34 patients were identified to have duplication mutations. In 46 mothers of patients with deletion mutations, 28 were identified the mutations;and of 8 mothers of patients with duplication mutations, 6 were identified the mutations. There was no statistical significance between the carrier incidences in the 2 groups. A 23 bp deletion of AGGGAACAGATCCTGGTAAAGCA fragment in exon 17 was found in a patient. Conclusions Comparing with the traditional quantitative methods, MLPA can detect the deletion and duplication mutation in all the 79 exons of dystrophin gene in DMD/BMD patients, and can identify the carrier status in their family members. Furthermore, MLPA is not apt to be interfered by the concentration and purity of DNA template.

Avaliação funcional e postural nas distrofias musculares de Duchenne e Becker / Functional and postural evaluation in duchenne and becker muscular dystrophies

Objetivo: O objetivo foi avaliar portadores de distrofia muscular de Duchenne (DMD) e Becker (DMB) por meio de escalas e análise postural. Metodologia: Foram avaliados 13 pacientes, idade 16,75 (± 6,9) sendo 9 DMD, 4 DMB, 7 cadeirantes, 6 não cadeirantes, nas escalas: Índice de Barthel e EK (Egen klassifikation). A avaliação postural sentada foi feita no software SAPO. Resultados: Os dados revelam que: aumento da idade (p<0.01), dependência de cadeira de rodas (p<0.01) e uso de ventilador (p<0.01) indicaram menor independência. Na avaliação postural tanto dos não cadeirantes quanto dos cadeirantes, verificou-se que aumentam os agrupamentos nos cadeirantes, remetendo às limitações impostas pela postura. Conclusão: Esses achados mostram que pacientes com DMD e DMB têm sua funcionalidade e atividades de vida diária debilitadas com o avanço da idade, dependência de cadeira de rodas e uso de ventilador. Assim, associação de escalas com avaliações convencionais e análise postural são ferramentas essenciais para a investigação.

Objective: The objective was to evaluate patients with Duchenne muscular dystrophy (DMD) and Becker (BMD) in scales and postural analysis. Methods: We evaluated 13 patients, age 16.75 (± 6.9) and 9 DMD, BMD 4, 7 wheelchair, wheelchair not 6, on the scales: Barthel Index and EK (Egen Klassifikation). The evaluation was performed in sitting posture software SAPO. Results: Data show that: increasing age (p <0.01), dependence on a wheelchair (p <0.01) and use of ventilator (p <0.01) showed less independence. Postural assessment of both the wheelchair and not the wheelchair, it was found that increase in the wheelchair groups, referring to the restrictions imposed by posture. Conclusion: These findings show that patients with DMD and BMD have its functionality and activities of daily living impaired with advancing age, dependence on a wheelchair and ventilator use. Thus, association of scales with conventional assessments and postural analysis are essential tools for research.

Use of multiplex ligation-dependent probe amplification (MLPA) for Duchenne muscular dystrophy (DMD) gene mutation analysis.

Background & objectives: Duchenne (DMD) and Becker muscular dystrophy (BMD) are X-linked recessive disorders, caused by mutations in the dystrophin gene. Genetic diagnosis of the proband becomes crucial, and forms the base for carrier analysis, genetic counselling, prediction of natural history and prognosis, and eligibility for therapeutic strategies. Traditional multiplex PCR assay is the common method used in India to detect DMD gene deletions, mainly in the hot-spot region. Deletions of exons outside the usual 18 or 21 exons in the hot-spot, duplications and carrier analysis are often left without precise genetic diagnosis and require efficient dosage/quantitative analysis. In this study we evaluated the efficacy of using multiplex PCR (mPCR) of 30 exons followed by multiplex ligation-dependent probe amplification (MLPA), to study deletions and duplications in the DMD gene in patients clinically diagnosed as BMD/DMD. Methods: Using an algorithm of mPCR and MLPA which was less invasive and cost-effective, we performed retrospective and prospective analysis on 150 male patients. Results: Multiplex PCR could pick up deletions in 103 of the 150 cases. MLPA was able to detect deletions and duplications including nine additional mutations. Further, the borders of the deletions and duplications were more accurately defined by this recent methodology, which enables one to determine the effect of the mutation on the reading frame. In all, including the single exon deletions, MLPA was efficient in accurately confirming mutations in 35 per cent of all cases. Ten novel mutations were identified in this study. Overall, this approach confirmed mutations in 75 per cent of the patients in our study. Interpretations & conclusions: The systematic approach/algorithm used in this study offers the best possible economical mutation analysis in the Indian scenario.

Clinical Usefulness of Molecular Diagnosis in Dystrophin Gene Mutations Using the Multiplex Ligation-dependent Probe Amplification (MLPA) Method

BACKGROUND: Duchenne/Becker muscular dystrophy (DMD/BMD), which is the most common X-linked muscular dystrophy, is caused by mutations in the dystrophin gene. These mutations comprise deletions in approximately 55~65% of patients, duplications in 5~10%, and point mutations or small insertion/deletions in the remainder. Unfortunately, current diagnostic assays for dystrophin do not accurately detect duplication mutations or female carriers. In this study we employed multiplex ligation-dependent probe amplification (MLPA) analysis to detect deletions or duplications of the dystrophin gene in patients with DMD/BMD, and in potential female carriers. METHODS: A total of 41 subjects was recruited for this study, comprising 35 male DMD/BMD patients, 1 female patient with Turner syndrome, and 5 females with a family history of DMD/BMD. The MLPA method was employed to determine the copy number of each of the 79 exons of the dystrophin gene in the 41 subjects. RESULTS: MLPA analysis for dystrophin was informative in 71.4% (25/35) of patients with DMD/BMD patients, identifying deletions in 60.0% (21/35) and duplications in 11.4% (4/35). MLPA analysis showed the presence of a deletion of the DMD gene in one female patient with Turner syndrome. Of the five female patients with a family history of DMD/BMD, this assay revealed exon deletion in one and duplications in one. CONCLUSIONS: The reported findings reveal that the MLPA method is a powerful tool for detecting duplications and female carriers, as well as DMD gene deletions. MLPA should be considered the method of choice for an initial genetic analysis of DMD/BMD patients.

Depressive Symptoms and Subjective Quality of Life in Parents of Boys with Duchenne/Becker Muscular Dystrophy

OBJECTIVES: The purpose of the current study was to evaluate subject quality of life in depressed parents of boys with Duchenne/Becker muscular dystrophy (DMB/BMD). In addition, a specific relationship between subject quality of life and the severity of depressive symptom was explored. METHODS: The participants were 15 depressed parents who had moderate to severe depressive symptoms and 35 non-depressed parents of boys with DMD/BMD. All participants completed the World Health Organization Quality Of Life Scale, Brief Version and the Beck Depression Inventory. Other instruments included the Family Relationship Scale and the Child Behavior Checklist. RESULTS: Among various model predictors, only higher score on the Beck Depression Inventory predicted lower scores on all domains of the World Health Organization Quality Of Life Scale, Brief Version. In addition, depressed parents had significantly lower scores on all domains of the World Health Organization Quality Of Life Scale, Brief Version including physical health, psychological health, social relationships, and environment, relative to non-depressed parents. CONCLUSION: Findings of the current study suggest that all domains of subjective quality of life may be influenced by depressive symptoms in parents of boys with DMD/BMD.

The Clinical Features, Immunostaining and Genetic Study in Duchenne/Becker Muscular Dystrophy

PURPOSE: This retrospective study was designed to know the relation between clinical features, genetics, and immunostaining findings among children with Duchenne muscular dystrophy (DMD)/Becker muscular dystrophy (BMD) and the validity of the diagnostic tools for muscular dystrophy. METHODS: The medical records and computerized databases of 93 patients diagnosed with DMD/BMD from June 1989 to December 2008 were reviewed retrospectively. Demographic characteristics including clinical features, serum creatinine kinase(CK) level, electromyogram(EMG) and nerve conduction velocity(NCV), muscle biopsy, immunochemical staining for dystrophin, and the deletion of dystrophin gene were analyzed. We calculate the concordance rate between type of frame (in or out of frame) and phenotype. RESULTS: 58(62%) children were diagnosed with DMD, 13(14%) BMD, 19(20%) unclassified dystrophy, and 3(3%) DMD/BMD carriers. The mean age of symptom onset was 5.0+/-3.5 years(range, 1-17). 46(49%) children presented gait disturbance and 35(37%) elevation of liver enzymes. The mean value of serum CK enzyme was 14,758+/-11,792 IU/L (range, 633-61,349). There was no dystrophin in the immunochemical stain among 48 DMD children and at least partial or incomplete dystrophin among 10 BMD children. 28/54(51%) children had dystrophin gene deletion in multiplex PCR and 13/14(92%) in Multiplex Ligation-dependent Probe Amplification(MLPA). The loss of heterozygosity was shown in 2 children by MLPA. The overall concordance rate between type of frame(in or out of frame) and phenotype was 95% in this study. CONCLUSION: Despite of small population, this finding indicates that the determination of type of frame (in or out of frame) by MLPA may be helpful in differential diagnosis of DMD/BMD. In addition, we surmise that the detection of carrier by MLPA is helpful in genetic counseling.

Detection of deletions and duplications in the Duchenne muscular dystrophy gene by the molecular method MLPA in the first Argentine affected families

Deletions/duplications in the Duchenne muscular dystrophy (DMD) gene account for 60 to 70% of all alterations. A new technique, multiplex ligation-dependent probe amplification (MLPA), has been described that allows the detection of large genetic rearrangements by simultaneous amplification of up to 45 target sequences. The present article is based on the diagnosis of the first Argentine affected families by the application of MLPA. DNA samples from patients with and without a previous diagnosis were included. MLPA assays were performed according to manufacturer recommendations. Polymerase chain reaction and direct sequencing were performed when a single-exon deletion was detected. Results were analyzed using the Gene Marker v1.6 and Sequencing Analysis v5.2 software. In the samples with a previous diagnosis (as identified by short tandem repeat-polymerase chain reaction analysis), MLPA confirmed in some samples the same deletion and detected in others a larger deleted fragment. This enabled the prediction of the expected male phenotype. One deletion and one duplication were detected in patients without previous diagnosis. In this study, we investigated the applicability of MLPA in our country. Our results showed a 100% confirmation of the deleted fragments detected by short tandem repeat segregation analysis. Moreover, in some cases, the MLPA assay was able to refine the breakpoints involved. In addition, MLPA identified deletions/duplications in samples without previous diagnosis. In comparison to the available diagnosis strategies in Argentina, MLPA is less time-consuming, and spans the complete coding region of DMD. The application of MLPA will improve the genetic diagnosis of DMD/Becker muscular dystrophy in our country.

Diagnostic testing for Duchenne/Becker Muscular dystrophy using Dual Priming Oligonucleotide (DPO) system

PURPOSE: Large exon deletions in the DMD gene are found in about 60% of DMD/BMD patients. Multiplex PCR has been employed to detect the deletion mutation, which frequently generates noise PCR products due to the presence of multiple primers in a single reaction as well as the stringency of PCR conditions. This often leads to a false-negative or false-positive result. To address this problematic issue, we introduced the dual primer oligonucleotide (DPO) system. DPO contains two separate priming regions joined by a polydeoxyinosine linker that results in high PCR specificity even under suboptimal PCR conditions. METHODS: We tested 50 healthy male controls, 50 patients with deletion mutation as deletion-positive patient controls, and 20 patients with no deletions as deletion-negative patient controls using DPO- multiplex PCR. Both the presence and extent of deletion were verified by simplex PCR spanning the promoter region (PM) and 18 exons including exons 3, 4, 6, 8, 12, 13, 17, 19, 43-48, 50-52, and 60 in all 120 controls. RESULTS: DPO-multiplex PCR showed 100% sensitivity and specificity for the detection a deletion. However, it showed 97.1% sensitivity and 100% specificity for determining the extent of deletions. CONCLUSION: The DPO-multiplex PCR method is a useful molecular test to detect large deletions of DMD for the diagnosis of patients with DMD/BMD because it is easy to perform, fast, and cost-effective and has excellent sensitivity and specificity.